Journal: Cell Biology and Toxicology

Article Title: CD36 inhibition reduces non-small-cell lung cancer development through AKT-mTOR pathway

doi: 10.1007/s10565-024-09848-7

Figure Lengend Snippet: CD36 expression is positively correlated with cell proliferation and migration in vitro . A–F A549 cells were transfected with pCMV or pCMV-CD36 plasmid, and NCI-H520 cells were transfected with CasRX or CasRX-CD36 plasmid for 12 h in serum-free medium and then cultured in complete medium for another 24 h. Cells were collected for determination of cell viability ( A ), cell cycle ( B , C ), migration ( D ), and apoptosis ( E ) by MTT assay, FACS, wound healing test, and Annexin V-FITC/PI staining, respectively. Protein expression of CD36, CDH1, PCNA, vimentin, Bcl-2, and BAX was determined by Western blot with density quantitative analysis ( F ). G , H NCI-H520 cells were transfected with CasRX or CasRX-CD36 plasmid for 12 h and then cultured in complete medium for 24 h, followed by FFAs (150 µM) treatment for 24 h. Cells were collected for determination of cell viability ( G ) and apoptosis ( H ). Mean ± SEM; * p < 0.05; ** p < 0.01; *** p < 0.001; A , G : n = 6; B – F , H : n = 3

Article Snippet: CasRx gRNA cloning backbone (pXR003, #109053, Addgene) was digested with BbsI and then ligated with annealed oligo duplex using T4 ligase.

Techniques: Expressing, Migration, In Vitro, Transfection, Plasmid Preparation, Cell Culture, MTT Assay, Staining, Western Blot

Journal: Cell Biology and Toxicology

Article Title: CD36 inhibition reduces non-small-cell lung cancer development through AKT-mTOR pathway

doi: 10.1007/s10565-024-09848-7

Figure Lengend Snippet: The effects of pitavastatin on cell proliferation, migration, and apoptosis are related to CD36 expression. A549 cells were transfected with pCMV or pCMV-CD36 plasmid, and NCI-H520 cells were transfected with CasRX or CasRX-CD36 plasmid for 12 h and then cultured in complete medium for 24 h, followed by received pitavastatin (5 µM) treatment for 24 h. Cells were collected for determination of cell viability ( A ), cell cycle ( B , C ), migration ( D ), and apoptosis ( E ). Protein expression of CD36, PCNA, Bcl-2, and BAX was determined by Western blot with density quantitative analysis ( F , G ). Mean ± SEM; * p < 0.05; ** p < 0.01; *** p < 0.001; A : n = 6; B – F : n = 3; Pita, pitavastatin

Article Snippet: CasRx gRNA cloning backbone (pXR003, #109053, Addgene) was digested with BbsI and then ligated with annealed oligo duplex using T4 ligase.

Techniques: Migration, Expressing, Transfection, Plasmid Preparation, Cell Culture, Western Blot

Journal: Cell Biology and Toxicology

Article Title: CD36 inhibition reduces non-small-cell lung cancer development through AKT-mTOR pathway

doi: 10.1007/s10565-024-09848-7

Figure Lengend Snippet: The reduction effects of pitavastatin on tumor progression are regulated by CD36/AKT/mTOR pathway. A–E A549 ( A ) and NCI-H520 ( B ) cells were treated with 150 µM FFAs or 5 µM pitavastatin plus FFAs for 24 h. A549 cells were transfected with pCMV or pCMV-CD36 plasmid for 12 h ( C ); NCI-H520 cells were transfected with CasRX or CasRX-CD36 plasmid ( D , E ) for 12 h and then cultured in complete medium for 24 h, followed by treatment with 5 µM pitavastatin ( C , D ) or 150 µM FFAs ( E ) for 24 h. Protein expression of p-AKT, AKT, p-mTOR, and mTOR was detected by Western blot. F , G Tumor paraffin sections collected from Fig. A ( F ) or Fig. A ( G ) were performed IHC staining to detect the expression of p-AKT and p-mTOR with MD quantified by ImageJ software. H–L A549 cells were transfected with pCMV or pCMV-CD36 plasmid for 12 h and then cultured in complete medium for 24 h, followed by received LY294002 (10 µM) treatment for 24 h. Cells were collected for determination of cell viability ( H ) and apoptosis ( I , J ). Protein expression of CD36, vimentin, PCNA, BAX, p-AKT, AKT, p-mTOR, and mTOR was determined by Western blot ( K , L ). Mean ± SEM; * p < 0.05; ** p < 0.01; *** p < 0.001; A – E , I – L : n = 3; F , G : n = 5; H : n = 6; Pita, pitavastatin; LY, LY294002

Article Snippet: CasRx gRNA cloning backbone (pXR003, #109053, Addgene) was digested with BbsI and then ligated with annealed oligo duplex using T4 ligase.

Techniques: Transfection, Plasmid Preparation, Cell Culture, Expressing, Western Blot, Immunohistochemistry, Software

Journal: The EMBO Journal

Article Title: Fxr1 regulates sleep and synaptic homeostasis

doi: 10.15252/embj.2019103864

Figure Lengend Snippet: A Fxr1 targeting gRNA sequences and corresponding protospacer adjacent motifs (PAMs). B Evaluation of Fxr1 targeting sgRNAs by SURVEYOR assay 2 days after transfection of sgRNAs and SpCas9 (asterisks indicate the presence of digested bands). C Western blot analysis and quantification of Gsk3β and Fxr1 expression in Neuro2A cells 7 days after transfection of CRISPR/Cas9 constructs (Ctrl n = 6, Fxr1KO n = 7, Student's t ‐test, *** P < 0.001). Bars and error bars are mean ± SEM. D Schematic representation of low‐efficiency transfection of primary neuronal cultures with various plasmids. E–G Evaluation of CRISPR/Cas9 KO of (E) Gsk3b , (F) Fxr1 , and (G) Gsk3b/Fxr1 in primary neuronal cultures by immunostaining. Arrows indicate presence and arrowheads absence of staining. H Quantification of CRISPR/Cas9 KO of Gsk3b and Fxr1 .

Article Snippet: For primary neuronal culture, transfection previously characterized Gsk3b gRNA oligonucleotide (Khlghatyan et al , ) was cloned into pX458 (pSpCas9(BB)‐2A‐GFP (PX458) was a gift from Feng Zhang (Addgene plasmid # 48138)) (Ran et al , ) vector by single‐step cloning using BbsI restriction sites to generate Gsk3 KO construct. pX458 vector was used as a control (Gsk3 Ctrl construct).

Techniques: Transfection, Western Blot, Expressing, CRISPR, Construct, Immunostaining, Staining

Journal: PLoS Genetics

Article Title: Nicotinic acetylcholine receptor modulator insecticides act on diverse receptor subtypes with distinct subunit compositions

doi: 10.1371/journal.pgen.1009920

Figure Lengend Snippet: (A) Schematic of the nAChRβ1 locus and the sequence of the donor construct. The boxes represent exons, and the coding regions are shown in blue. The gRNA sequence is indicated in red, and the codon for amino acid substitution (CGT to ACT) is highlighted in green. One synonymous mutation (G to A) is also introduced in the PAM region (in yellow) to prevent recleavage from Cas9 after successful integration. (B) Sequence comparison between wild-type flies and flies with point mutations. The nucleotides replaced are highlighted in green and yellow boxes.

Article Snippet: The gRNA sequence (3 L:4433329~4433352, ATCAAACGTTTGGTTAACTTTAG) was designed with flyCRISPR Target Finder ( https://flycrispr.org/target-finder/ ) and cloned into the pDCC6 plasmid (Addgene #59985).

Techniques: Sequencing, Construct, Mutagenesis, Comparison